This Article

Citations


Creative Commons License
Except where otherwise noted, this work is licensed under Creative Commons Attribution-NonCommercial 4.0 International License.

Isolation of Methicillin-Resistant Staphylococcus aureus Strains Producing Enterotoxins A, K and Q From Chicken Meat in Isfahan, Iran, 2014


1 Department of Microbiology, Faculty of Science, University of Isfahan, Isfahan, IR Iran
*Corresponding author: Fateh Rahimi, Department of Microbiology, Faculty of Science, University of Isfahan, Isfahan, IR Iran. Tel: +98-3137932250, E-mail: f.rahimi@sci.ui.ac.ir.
Archives of Clinical Infectious Diseases. 11(4): e35601 , DOI: 10.5812/archcid.35601
Article Type: Research Article; Received: Dec 18, 2015; Revised: Aug 8, 2016; Accepted: Aug 20, 2016; epub: Aug 27, 2016; collection: Oct 2016

Abstract


Background: Methicillin-resistant Staphylococcus aureus (MRSA) strains are known as one of the most common causes of infection in humans and animals can produce a variety of virulence factors such as enterotoxins. Staphylococcal food poisoning is one of the most common food-borne diseases in the world.

Objectives: The current experimental study aimed to isolate and determine the clonality of MRSA strains isolated from chicken meat samples, and describe the presence of different prophage types, enterotoxin genes and also the expression of Staphylococcus cassette chromosome mec (SCCmec) gene types.

Methods: During six months in 2014, a total of 36 chicken meat samples were collected from Isfahan local markets and analyzed to screen MRSA strains. All isolates were typed using high resolution automated Phene plate (PhP) system and tested for the presence of different enterotoxin genes. Different staphylococcal cassette chromosome mec (SCCmec) and prophage types were determined.

Results: All 116 isolated MRSA strains were discriminated into seven PhP types consisting of seven common types (CTs) and were positive for mecA gene. All isolates harbored SCCmec type III and SGF, SGFa and SGFb prophage types. Genes encoding enterotoxins SEA, SEK and SEQ were detected in all MRSA isolates.

Conclusions: These findings illustrated the presence and persistence of clonal groups of MRSA strains, in chicken meat in Isfahan, Iran, that serve as reservoirs to disseminate bacteriophage encoded enterotoxin and virulence agents.

Keywords: Methicillin-Resistant Staphylococcus aureus; Bacterial Typing Techniques; Prophage

1. Background


Staphylococcus aureus is one of the most important causes of food poisoning in the world, which is due to production of a broad spectrum of staphylococcal enterotoxins (SEA-SEV) (1). Staphylococcal enterotoxins are members of staphylococcal and streptococcal exotoxins related together and consisting of pyrogenic proteins known as superantigens and may cause proliferation of the T-cells and produce cytokines. Enterotoxins are heat resistant small secretory proteins that show high resistance to digestive enzymes which enables them to be active in the gastrointestinal (GI) tract (2). Staphylococcal food poisoning is one of the most common food-borne diseases in the world characterized by vomiting, nausea, diarrhea and abdominal cramps (3, 4).


Different mobile genetic elements such as bacteriophages, plasmids and pathogenicity islands (PI) can confer the ability of production of a variety of virulence factors among S. aureus strains (1, 5). SEA, SEE, SEK, SEP and SEQ are bacteriophage encoded enterotoxins, in which SEA is the most frequent agent of food poisoning related staphylococcal enterotoxin (1). Bacteriophages convert the non-virulent bacteria to virulent ones through lysogenic phage conversion and play an important role in pathogenesis of S. aureus strains (6, 7). Staphylococcal bacteriophages belong to Myoviridae and Siphoviridae families and classification of bacteria according to the presence of different classes of prophages indicating the potential of bacteria to produce a variety of virulence factors (7, 8).


S. aureus strains can acquire resistance genes through horizontal gene transfer mechanisms which enable them to show resistance against anti-microbial agents and spread worldwide (5). Methicillin is one of the most important antibiotics, used first in 1960 to treat penicillin-resistant S. aureus strains, and first methicillin-resistant S. aureus (MRSA) strains were reported only one year after identification in 1961 and then spread in hospitals and the communities worldwide (9). Resistance to methicillin is due to the presence of mecA gene, which is a part of a large cluster called staphylococcal cassette chromosome mec (SCCmec). Eleven different SCCmec types are reported and typing of bacteria using the presence of different SCCmec types could be a useful method to classify MRSA strains (9, 10).

2. Objectives


The current experimental study aimed to isolate and evaluate the clonality of MRSA strains isolated from chicken meat samples and describe the presence of different prophage types, enterotoxin genes and also occurrence of the staphylococcus cassette chromosome mec (SCCmec) gene types.

3. Methods


3.1. Sampling and Identification of Isolates

From July to December 2014, a total of 36 chicken meat samples were collected from markets in Isfahan, Iran. All samples were collected in sterile bottles and transported to the lab in a cold chain. For sample preparation, 100 grams of each chicken meat samples were suspended in 900 mL phosphate buffered saline (PBS) and vortexed for five minutes and then filtered using 0.45 µm filter membrane (Merck Millipore, Darmstadt, Germany), as described previously (11). Filters were transported on selective chromogenic MRSA-ID agar (Oxoid Brilliance MRSA Agar, Thermo Fisher Scientific, Waltham, MA, USA) and incubated for 48 hours at 37°C. Colonies suspected of being MRSA strains were also collected and analyzed. All colonies were identified at the species level using specific ,nucA primers (12) and tested for the presence of mecA gene (13). Different primers used in this study are listed in Table 1. Moreover, all primers were synthesized by TIB Molbiol Syntheselabor GmbH (Berlin, Germany). DNA extraction of MRSA strains was carried out using a High Pure PCR Template Preparation Kit (Roche, Mannheim, Germany) according to the manufacturer instructions.


Table 1.
Primers Used in the Study

3.2. PhP Typing

All MRSA isolates were typed using high resolution PhP system (PhPlate AB, Stockholm, Sweden) as described by Rahimi et al. (9).


3.3. SCCmec Typing of MRSA Strains

A multiplex-polymerase chain reaction (PCR) assay with eight pairs of primers (SCCmec types and subtypes I, II, III, IVa, IVb, IVc, IVd and V) (14) were used for SCCmec typing of MRSA strains according to the PCR cycle conditions introduced previously (10).


3.4. Prophage Typing of MRSA Strains

All MRSA strains were subjected to a multiplex-PCR assay with specific primers for SGA (phage type 3A), SGB (phage type 11), SGF (phage type 77), SGFa (phage type 77a), SGFb (phage type 77b), SGD (Twort-like phages) and SGL (phage type 187) prophage types as described previously (8).


3.5. Detection of Enterotoxin Genes

The presence of different enterotoxin genes (sea-seq) among MRSA strains were examined using separate PCR assays according to the protocols reported previously (12, 15).

4. Results


4.1. Identification of Isolates

In the current study, a total of 116 colonies were collected from chicken meat samples (25 samples out of 36; 69.4%). Moreover, 11 meat samples were negative for MRSA isolates. All isolates were identified as S. aureus strains using nucA specific primers and positive for the presence of mecA gene and confirmed as MRSA strains.


4.2. PhP Typing

The results of PhP typing showed that all 116 MRSA isolates were discriminated into seven PhP types consisting of seven common types (CTs) and no single types (ST) were detected among the isolates (Table 2, Figure 1). Each common type consisted of 2 - 47 strains and CT2 was the dominant type in which the highest number of MRSA strains was categorized in this CT (n = 47, 41%). Twenty eight (24%) and 25 (22%) MRSA isolates were categorized in CT3 and CT4, respectively.


Table 2.
The Prevalence of Different Types of PhP, SCCmec, Prophage and Enterotoxin Genes Among MRSA Isolates

Figure 1.
The Unweighted Pair Group Method With Arithmetic Averages Dendrogram of the Representative PhP Patterns of The MRSA Isolates

4.3. SCCmec Typing

In the current study, only one SCCmec type was detected among MRSA strains and all isolates harbored SCCmec type III and were classified as hospital acquired (HA)-MRSA strains (Table 2).


4.4. Prophage typing

Three different prophage types and one prophage pattern were detected among MRSA strains and 100% of the strains were positive for SGF, SGFa and SGFb prophage types (Table 2).


4.5. Detection of Enterotoxin Genes

Among all 116 MRSA strains, sea, sek and seq genes encoding SEA, SEK and SEQ were detected and all strains were negative for the presence of other eneterotoxin genes (Table 2).

5. Discussion


The current study isolated MRSA strains from chicken meat samples collected from different local markets in Isfahan in six months. The isolation of MRSA from different meat samples was reported previously from different countries (16-23). Another study (10) reported MRSA strains from poultries in Iran; therefore, the isolation of MRSA strains from chicken meat was not surprising.


Meat can become contaminated by several means reported previously. Most of the scientists indicated that meat contamination may occur during the slaughtering process of MRSA-positive animals which results in contamination of carcasses (17). On the other hand, the contamination might be due to contact of humans with large numbers of animals in the farms (24). In addition, improper handling of the meat at the slaughterhouse, processing facilities, storage of food at high temperature at the retail stores and close contact with butchers are some of the possible reasons for contamination of the meat samples (24).


All MRSA strains in the current study harbored SCCmec type III as an indicator of HA-MRSA strains. These findings were consistent with previous studies in Iran, in which SCCmec type III was the dominant type among MRSA strains isolated from clinical, environmental and animal samples (9, 10, 25-30). These findings indicate the hospital source of MRSA strains in the study.


Only one prophage pattern and three prophage types were detected in the present study and were common among all isolates. In other studies, different prophage types and prophage patterns were reported from Iran and other countries (6-9, 27, 29, 31). Although in different studies more prophage types and patterns were reported, the SGF prophage type and current prophage pattern were common among all MRSA isolates with different sources. The presence of common prophage patterns in hospitals, environments, animals and foodstuffs indicate the circulation of some clonal types in Iran. MRSA strains harboring this prophage pattern can produce different virulence factors such as enterotoxins A, K and Q, staphylokinase and beta-lysine. A previous study showed that community acquired MRSA (CA-MRSA) harbored SGA prophage type responsible for production of panton-valentine leukocidin (PVL) and this prophage type could be also another marker for CA-MRSA isolates (9).


The results of PhP typing indicated the presence of seven CTs among MRSA strains isolated from chicken meat. CT2 was the dominant PhP type (comprised of 41% of the isolates) in the present study that was in agreement with other reports from the clinics and sewages in Iran (9, 27, 28, 30) indicating an epidemiological link between the MRSA strains isolated from different sources. All seven CTs found in the present study, were also reported from clinical samples and were associated with human infections. These findings suggest that these strains were introduced to meat during meat processing or packing, subsequent to slaughtering. Different studies showed that MRSA strains are endemic in different sources in Iran; therefore contamination of meat in post-slaughtering process may not be responsible for the presence of these strains in food or animals. Other reports showed that the prevalence of STs among MRSA strains was limited to the strains that harbored SGA prophage type and also SCCmec type IV and classified as CA-MRSA strains (9, 10, 27).


Among all 116 MRSA strains, only three enterotoxin genes encoding for SEA, SEK and SEQ were detected. These enterotoxins are prophage encoded with different phage types such as ΦSa3ms, ΦSa3mw, Φ252B, ΦNM3 and ΦMu50a, which are members of SGF, SGFa and SGFb prophage types (1). It was also shown that all MRSA strains harbored SGF, SGFa and SGFb prophage types; therefore, the presence of sea, sek and seq genes was not surprising. This finding was not in agreement with those of other studies, in which the prevalence of these genes was significantly lower (12, 15, 32-41). On the other hand, the high prevalence of sea, sek and seq genes was shown in MRSA strains isolated from patients in a referral hospital in Tehran, Iran (42). The higher prevalence of sea, sek and seq genes among MRSA isolates in the current study could be, in part, due to geographical locations and different ecological settings where these studies were performed and also the fact that all 116 MRSA strains were spread from hospitals into the community and also that diversity of all strains was limited to seven CTs.


5.1. Conclusion

These findings illustrated the prevalence of clonal groups of MRSA strains in chicken meat in Isfahan, Iran. These strains were similar to MRSA strains isolated from hospitals in Iran, which indicated the important role of hospitals in dissemination of clinical isolates in the community. The presence of different prophage types among MRSA strains indicated the high potential of virulent strains to serve as reservoirs for dissemination of bacteriophage encoded enterotoxin and virulence agents.

Acknowledgments

The authors would like to thank Mr. Sadeghi for providing the samples.

Footnotes

Authors’ Contribution: Fateh Rahimi: conducting the experiments, supervising and developing the study concept, design and critical revision of the manuscript; Sharmin Karimi: conducting the experiments, developing the study and preparing the draft of manuscript.
Funding/Support: This research was funded, in part, by a grant from the vice chancellor for research and technology at University of Isfahan, Iran, for new academic staff.

References


  • 1. Argudin MA, Mendoza MC, Rodicio MR. Food poisoning and Staphylococcus aureus enterotoxins. Toxins (Basel). 2010;2(7):1751-73. [DOI] [PubMed]
  • 2. Ortega E, Abriouel H, Lucas R, Galvez A. Multiple roles of Staphylococcus aureus enterotoxins: pathogenicity, superantigenic activity, and correlation to antibiotic resistance. Toxins (Basel). 2010;2(8):2117-31. [DOI] [PubMed]
  • 3. Kerouanton A, Hennekinne JA, Letertre C, Petit L, Chesneau O, Brisabois A, et al. Characterization of Staphylococcus aureus strains associated with food poisoning outbreaks in France. Int J Food Microbiol. 2007;115(3):369-75. [DOI] [PubMed]
  • 4. Schelin J, Wallin-Carlquist N, Cohn MT, Lindqvist R, Barker GC, Radstrom P. The formation of Staphylococcus aureus enterotoxin in food environments and advances in risk assessment. Virulence. 2011;2(6):580-92. [DOI] [PubMed]
  • 5. Malachowa N, DeLeo FR. Mobile genetic elements of Staphylococcus aureus. Cell Mol Life Sci. 2010;67(18):3057-71. [DOI] [PubMed]
  • 6. Rahimi F, Bouzari M, Katouli M, Pourshafie M. Prophage typing of methicillin resistant Staphylococcus aureus isolated from a tertiary care hospital in Tehran, Iran. Jundishapur J Microbiol. 2013;6(1):80-5.
  • 7. Rahimi F, Bouzari M, Katouli M, Pourshafie MR. Prophage and antibiotic resistance profiles of methicillin-resistant Staphylococcus aureus strains in Iran. Arch Virol. 2012;157(9):1807-11. [DOI] [PubMed]
  • 8. Pantucek R, Doskar J, Ruzickova V, Kasparek P, Oracova E, Kvardova V, et al. Identification of bacteriophage types and their carriage in Staphylococcus aureus. Arch Virol. 2004;149(9):1689-703. [PubMed]
  • 9. Rahimi F, Katouli M, Pourshafie MR. Characteristics of hospital- and community-acquired meticillin-resistant Staphylococcus aureus in Tehran, Iran. J Med Microbiol. 2014;63(Pt 6):796-804. [DOI] [PubMed]
  • 10. Rahimi F, Karimi S. Characteristics of methicillin resistant staphylococcus aureus strains isolated from poultry in iran. Arch Clin Infect Dis. 2015;10(4) [DOI]
  • 11. Talebi M, Sadeghi J, Rahimi F, Pourshafie MR. Isolation and Biochemical Fingerprinting of Vancomycin-Resistant Enterococcus faecium From Meat, Chicken and Cheese. Jundishapur J Microbiol. 2015;8(4):15815. [DOI] [PubMed]
  • 12. Zouharova M, Rysanek D. Multiplex PCR and RPLA Identification of Staphylococcus aureus enterotoxigenic strains from bulk tank milk. Zoonoses Public Health. 2008;55(6):313-9. [DOI] [PubMed]
  • 13. McClure JA, Conly JM, Lau V, Elsayed S, Louie T, Hutchins W, et al. Novel multiplex PCR assay for detection of the staphylococcal virulence marker Panton-Valentine leukocidin genes and simultaneous discrimination of methicillin-susceptible from -resistant staphylococci. J Clin Microbiol. 2006;44(3):1141-4. [DOI] [PubMed]
  • 14. Zhang K, McClure JA, Elsayed S, Louie T, Conly JM. Novel multiplex PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J Clin Microbiol. 2005;43(10):5026-33. [DOI] [PubMed]
  • 15. Sergeev N, Volokhov D, Chizhikov V, Rasooly A. Simultaneous analysis of multiple staphylococcal enterotoxin genes by an oligonucleotide microarray assay. J Clin Microbiol. 2004;42(5):2134-43. [PubMed]
  • 16. Bhargava K, Wang X, Donabedian S, Zervos M, de Rocha L, Zhang Y. Methicillin-resistant Staphylococcus aureus in retail meat, Detroit, Michigan, USA. Emerg Infect Dis. 2011;17(6):1135-7. [DOI] [PubMed]
  • 17. de Boer E, Zwartkruis-Nahuis JT, Wit B, Huijsdens XW, de Neeling AJ, Bosch T, et al. Prevalence of methicillin-resistant Staphylococcus aureus in meat. Int J Food Microbiol. 2009;134(1-2):52-6. [DOI] [PubMed]
  • 18. Hanson BM, Dressler AE, Harper AL, Scheibel RP, Wardyn SE, Roberts LK, et al. Prevalence of Staphylococcus aureus and methicillin-resistant Staphylococcus aureus (MRSA) on retail meat in Iowa. J Infect Public Health. 2011;4(4):169-74. [DOI] [PubMed]
  • 19. Jackson CR, Davis JA, Barrett JB. Prevalence and characterization of methicillin-resistant Staphylococcus aureus isolates from retail meat and humans in Georgia. J Clin Microbiol. 2013;51(4):1199-207. [DOI] [PubMed]
  • 20. Lozano C, Lopez M, Gomez-Sanz E, Ruiz-Larrea F, Torres C, Zarazaga M. Detection of methicillin-resistant Staphylococcus aureus ST398 in food samples of animal origin in Spain. J Antimicrob Chemother. 2009;64(6):1325-6. [DOI] [PubMed]
  • 21. Pu S, Han F, Ge B. Isolation and characterization of methicillin-resistant Staphylococcus aureus strains from Louisiana retail meats. Appl Environ Microbiol. 2009;75(1):265-7. [DOI] [PubMed]
  • 22. van Loo IH, Diederen BM, Savelkoul PH, Woudenberg JH, Roosendaal R, van Belkum A, et al. Methicillin-resistant Staphylococcus aureus in meat products, the Netherlands. Emerg Infect Dis. 2007;13(11):1753-5. [DOI] [PubMed]
  • 23. Weese JS, Reid-Smith R, Rousseau J, Avery B. Methicillin-resistant Staphylococcus aureus (MRSA) contamination of retail pork. Can Vet J. 2010;51(7):749-52. [PubMed]
  • 24. Lozano C, Gharsa H, Ben Slama K, Zarazaga M, Torres C. Staphylococcus aureus in animals and food: Methicillin resistance, prevalence and population structure. A review in the african continent. Microorganisms. 2016;4(1):12. [DOI]
  • 25. Fatholahzadeh B, Emaneini M, Gilbert G, Udo E, Aligholi M, Modarressi MH, et al. Staphylococcal cassette chromosome mec (SCCmec) analysis and antimicrobial susceptibility patterns of methicillin-resistant Staphylococcus aureus (MRSA) isolates in Tehran, Iran. Microb Drug Resist. 2008;14(3):217-20. [DOI] [PubMed]
  • 26. Japoni A, Jamalidoust M, Farshad S, Ziyaeyan M, Alborzi A, Japoni S, et al. Characterization of SCCmec types and antibacterial susceptibility patterns of methicillin-resistant Staphylococcus aureus in Southern Iran. Jpn J Infect Dis. 2011;64(1):28-33. [PubMed]
  • 27. Rahimi F, Bouzari M. Biochemical Fingerprinting of Methicillin-Resistant Staphylococcus aureus Isolated From Sewage and Hospital in Iran. Jundishapur J Microbiol. 2015;8(7):19760. [DOI] [PubMed]
  • 28. Rahimi F. Characterization of Resistance to Aminoglycosides in Methicillin-Resistant Staphylococcus aureus Strains Isolated From a Tertiary Care Hospital in Tehran, Iran. Jundishapur J Microbiol. 2016;9(1):29237. [DOI] [PubMed]
  • 29. Rahimi F, Katouli M, Karimi S. Biofilm production among methicillin resistant Staphylococcus aureus strains isolated from catheterized patients with urinary tract infection. Microb Pathog. 2016;98:69-76. [DOI] [PubMed]
  • 30. Rahimi F, Shokoohizadeh L. Characterization of methicillin resistant Staphylococcus aureus strains among inpatients and outpatients in a referral hospital in Tehran, Iran. Microb Pathog. 2016;97:89-93. [DOI] [PubMed]
  • 31. Workman M, Nigro O, Steward G. Identification of prophages in coastal water isolates of staphylococcus aureus. J Young Invest. 2006;15:1-8.
  • 32. Alibayov B, Zdenkova K, Sykorova H, Demnerova K. Molecular analysis of Staphylococcus aureus pathogenicity islands (SaPI) and their superantigens combination of food samples. J Microbiol Methods. 2014;107:197-204. [DOI] [PubMed]
  • 33. Aydin A, Sudagidan M, Muratoglu K. Prevalence of staphylococcal enterotoxins, toxin genes and genetic-relatedness of foodborne Staphylococcus aureus strains isolated in the Marmara Region of Turkey. Int J Food Microbiol. 2011;148(2):99-106. [DOI] [PubMed]
  • 34. Carfora V, Caprioli A, Marri N, Sagrafoli D, Boselli C, Giacinti G, et al. Enterotoxin genes, enterotoxin production, and methicillin resistance in staphylococcus aureus isolated from milk and dairy products in central Italy. Int Dairy J. 2015;42:12-5.
  • 35. Chao G, Bao G, Cao Y, Yan W, Wang Y, Zhang X, et al. Prevalence and diversity of enterotoxin genes with genetic background of Staphylococcus aureus isolates from different origins in China. Int J Food Microbiol. 2015;211:142-7. [DOI] [PubMed]
  • 36. Jarraud S, Peyrat MA, Lim A, Tristan A, Bes M, Mougel C, et al. egc, a highly prevalent operon of enterotoxin gene, forms a putative nursery of superantigens in Staphylococcus aureus. J Immunol. 2001;166(1):669-77. [PubMed]
  • 37. Omoe K, Ishikawa M, Shimoda Y, Hu DL, Ueda S, Shinagawa K. Detection of seg, seh, and sei genes in Staphylococcus aureus isolates and determination of the enterotoxin productivities of S. aureus isolates Harboring seg, seh, or sei genes. J Clin Microbiol. 2002;40(3):857-62. [PubMed]
  • 38. Saadati M, Barati B, Doroudian M, Shirzad H, Hashemi M, Hosseini SM, et al. Detection of Sea, Seb, Sec, Seq genes in staphylococcus aureus isolated from nasal carriers in Tehran province, Iran; by multiplex PCR. J Paramed Sci. 2011;2(2)
  • 39. Smyth DS, Hartigan PJ, Meaney WJ, Fitzgerald JR, Deobald CF, Bohach GA, et al. Superantigen genes encoded by the egc cluster and SaPIbov are predominant among Staphylococcus aureus isolates from cows, goats, sheep, rabbits and poultry. J Med Microbiol. 2005;54(Pt 4):401-11. [DOI] [PubMed]
  • 40. Spanu V, Spanu C, Virdis S, Cossu F, Scarano C, De Santis EP. Virulence factors and genetic variability of Staphylococcus aureus strains isolated from raw sheep's milk cheese. Int J Food Microbiol. 2012;153(1-2):53-7. [DOI] [PubMed]
  • 41. Xie Y, He Y, Gehring A, Hu Y, Li Q, Tu SI, et al. Genotypes and toxin gene profiles of Staphylococcus aureus clinical isolates from China. PLoS One. 2011;6(12):28276. [DOI] [PubMed]
  • 42. Rahimi F, Karimi S. Characteristics of virulence factors in methicillin-resistant staphylococcus aureus strains isolated from a referral hospital in Tehran, Iran. Arch Clin Infect Dis. 2016;11(1)

Table 1.

Primers Used in the Study

Gene Nucleotide Sequence (5′→3′ End) Molecular Weight, bp Reference
nucA F: AGTTCAGCAAATGCATCACA 400 (12)
R: TAGCCAAGCCTTGACGAACT
mecA F: GTAGAAATGACTGAACGTCCGATAA 310 (13)
R: CCAATTCCACATTGTTTCGGTCTAA
SCC mec type I F: GCTTTAAAGAGTGTCGTTACAGG 613 (14)
R: GTTCTCTCATAGTATGACGTCC
SCC mec type II F: CGTTGAAGATGATGAAGCG 398
R: CGAAATCAATGGTTAATGGACC
SCC mec type III F: CCATATTGTGTACGATGCG 280
R: CCTTAGTTGTCGTAACAGATCG
SCC mec type Iva F: GCCTTATTCGAAGAAACCG 776
R: CTACTCTTCTGAAAAGCGTCG
SCC mec type IVb F: TCTGGAATTACTTCAGCTGC 493
R: AAACAATATTGCTCTCCCTC
SCC mec type IVc F: ACAATATTTGTATTATCGGAGAGC 200
R: TTGGTATGAGGTATTGCTGG
SCC mec type IVd F: CTCAAAATACGGACCCCAATACA 881
R: TGCTCCAGTAATTGCTAAAG
SCC mec type V F: GAACATTGTTACTTAAATGAGCG 325
R: TGAAAGTTGTACCCTTGACACC
SGA prophage type F: TATCAGGCGAGAATTAAGGG 744 (8)
R: CTTTGACATGACATCCGCTTGAC
SGB prophage type F: ACTTATCCAGGTGGYGTTATTG 405
R: TGTATTTAATTTCGCCGTTAGTG
SGF prophage type F: CGATGGACGGCTACACAGA 155
R: TTGTTCAGAAACTTCCCAACCTG
SGFa prophage type F: TACGGGAAAATATTCGGAAG 548
R: ATAATCCGCACCTCATTCCT
SGFb prophage type F: AGACACATTAAGTCGCACGATAG 147
R: TCTTCTCTGGCACGGTCTCTT
SGL prophage type F: GCTTAAAACAGTAACGGTGACAGTG 748
R: TGCTACATCATCAAGAACACCTGG
sea F: TAAGGAGGTGGTGCCTATGG 180 (12)
R: CATCGAAACCAGCCAAAGTT
Seb F: TCGCATCAAACTGACAAACG 478
R: GCAGGTACTCTATAAGTGCC
Sec F: ACCAGACCCTATGCCAGATG 371
R: TCCCATTATCAAAGTGGTTTCC
Sed F: TCAATTCAAAAGAAATGGCTCA 339
R: TTTTTCCGCGCTGTATTTTT
See F: TACCAATTAACTTGTGGATAGAC 170
R: CTCTTTGCACCTTACCGC
Seg F: CCACCTGTTGAAGGAAGAGG 432
R: TGCAGAACCATCAAACTCGT
she F: TCACATCATATGCGAAAGCAG 463
R: TCGGACAATATTTTTCTGATCTTT
Sei F: CTCAAGGTGATATTGGTGTAGG 529
R: CAGGCAGTCCATCTCCTGTA
Sej F: GGTTTTCAATGTTCTGGTGGT 306
R: AACCAACGGTTCTTTTGAGG
Sel F: CACCAGAATCACACCGCTTA 204 (15)
R: CTGTTTGATGCTTGCCATTG
Sek F: ATGAATCTTATGATTTAATTTCAGAATCAA 545
R: ATTTATATCGTTTCTTTATAAGAAATATCG
Sem F: ATGAAAAGAATACTTATCATTGTTGTTTTATTG 720
R: CTTCAACTTTCGTCCTTATAAGATATTTC
Sen F: ATAAAAAATATTAAAAAGCTTATGAGATTGTTC 775
R: ACTTAATCTTTATATAAAAATACATCAATATG
Seo F: TATGTAGTGTAAACAATGCATATGCA 685
R: TCTATTGTTTTATTATCATTATAAATTTGCAAAT
Sep F: TTAGACAAACCTATTATCATAATGGAAGT 618
R: TATATAAATATATATCAATATGCATATTTTTAGACT
Seq F: GGAAAATACACTTTATATTCACAGTTTCA 539
R: ATTTATTCAGTTTTCTCATATGAAATCTC
Abbreviations: SCCmec, Staphylococcus cassette chromosome mec; MRSA, methicillin-resistant Staphylococcus aureus; CT, common type.

Table 2.

The Prevalence of Different Types of PhP, SCCmec, Prophage and Enterotoxin Genes Among MRSA Isolates

PhP Types SCCmec Type Prophage Types Enterotoxin Genes Number of Isolates (%)
SGA SGB SGF SGFa SGFb SGL sea Sek seq Other Genes
CT 1 III - - + + + - + + + - 8 (6.9)
CT 2 III - - + + + - + + + - 47 (40.5)
CT 3 III - - + + + - + + + - 28 (24.1)
CT 4 III - - + + + - + + + - 25 (21.6)
CT 5 III - - + + + - + + + - 3 (2.6)
CT 6 III - - + + + - + + + - 3 (2.6)
CT 7 III - - + + + - + + + - 2 (1.7)

Figure 1.

The Unweighted Pair Group Method With Arithmetic Averages Dendrogram of the Representative PhP Patterns of The MRSA Isolates